ID: 1132694184_1132694190

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1132694184 1132694190
Species Human (GRCh38) Human (GRCh38)
Location 16:1194740-1194762 16:1194761-1194783
Sequence CCGGGCCTGGGACCCTCACGGAG AGCAGAGCCCGGCCAGGCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 248} {0: 1, 1: 0, 2: 3, 3: 37, 4: 327}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!