ID: 1132694185_1132694204

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1132694185 1132694204
Species Human (GRCh38) Human (GRCh38)
Location 16:1194745-1194767 16:1194796-1194818
Sequence CCTGGGACCCTCACGGAGCAGAG CCTGGTGGCTGCTTTCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 211} {0: 1, 1: 0, 2: 3, 3: 33, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!