ID: 1132884899_1132884917

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1132884899 1132884917
Species Human (GRCh38) Human (GRCh38)
Location 16:2178367-2178389 16:2178400-2178422
Sequence CCCTTGGAGCCCCCGGCCAGGCG GGCGCCCCGGCCCGGGTCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 122} {0: 1, 1: 0, 2: 0, 3: 15, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!