ID: 1132987726_1132987737

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1132987726 1132987737
Species Human (GRCh38) Human (GRCh38)
Location 16:2776822-2776844 16:2776871-2776893
Sequence CCCGCGGCGAGCGCAGCTCGCGC CCCGCGGCTCGGGCGCCCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 133} {0: 1, 1: 0, 2: 3, 3: 26, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!