ID: 1133125539_1133125543

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1133125539 1133125543
Species Human (GRCh38) Human (GRCh38)
Location 16:3643534-3643556 16:3643550-3643572
Sequence CCCACCACGGAGCGGAGTGGGTG GTGGGTGAGCTGTCCCTGTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61} {0: 1, 1: 0, 2: 1, 3: 12, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!