ID: 1133139462_1133139464

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1133139462 1133139464
Species Human (GRCh38) Human (GRCh38)
Location 16:3733551-3733573 16:3733583-3733605
Sequence CCACACTAAGGTAAGACATTAGT AACTGCGTGCTGCAATATACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 27, 4: 183} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!