|
Left Crispr |
Right Crispr |
Crispr ID |
1133289430 |
1133289436 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:4709233-4709255
|
16:4709278-4709300
|
Sequence |
CCTGTCTCTCCCAAAAATGCAAA |
TGCCTGTAATCCCAGCTACTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 201, 2: 11536, 3: 190954, 4: 221603} |
{0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|