|
Left Crispr |
Right Crispr |
| Crispr ID |
1133289431 |
1133289436 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4709242-4709264
|
16:4709278-4709300
|
| Sequence |
CCCAAAAATGCAAAATTAGCCAG |
TGCCTGTAATCCCAGCTACTAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 4, 1: 90, 2: 158, 3: 472, 4: 3611} |
{0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|