ID: 1133289431_1133289443

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1133289431 1133289443
Species Human (GRCh38) Human (GRCh38)
Location 16:4709242-4709264 16:4709292-4709314
Sequence CCCAAAAATGCAAAATTAGCCAG GCTACTAGGGAGGCTGAGGCAGG
Strand - +
Off-target summary {0: 4, 1: 90, 2: 158, 3: 472, 4: 3611} {0: 6336, 1: 175987, 2: 235818, 3: 172632, 4: 171596}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!