|
Left Crispr |
Right Crispr |
Crispr ID |
1133289431 |
1133289443 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
16:4709242-4709264
|
16:4709292-4709314
|
Sequence |
CCCAAAAATGCAAAATTAGCCAG |
GCTACTAGGGAGGCTGAGGCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 4, 1: 90, 2: 158, 3: 472, 4: 3611} |
{0: 6336, 1: 175987, 2: 235818, 3: 172632, 4: 171596} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|