|
Left Crispr |
Right Crispr |
| Crispr ID |
1133289432 |
1133289443 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
16:4709243-4709265
|
16:4709292-4709314
|
| Sequence |
CCAAAAATGCAAAATTAGCCAGA |
GCTACTAGGGAGGCTGAGGCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 19, 2: 289, 3: 443, 4: 909} |
{0: 6336, 1: 175987, 2: 235818, 3: 172632, 4: 171596} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|