ID: 1133324254_1133324262

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1133324254 1133324262
Species Human (GRCh38) Human (GRCh38)
Location 16:4933924-4933946 16:4933976-4933998
Sequence CCTGCGGCCGCTTATCATTCACA CTGAGCCAACATCGCCAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 36} {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!