ID: 1133324258_1133324262

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1133324258 1133324262
Species Human (GRCh38) Human (GRCh38)
Location 16:4933954-4933976 16:4933976-4933998
Sequence CCCTGCATTATTTCATTTAATCC CTGAGCCAACATCGCCAGGCAGG
Strand - +
Off-target summary {0: 4, 1: 9, 2: 104, 3: 337, 4: 1082} {0: 1, 1: 0, 2: 0, 3: 9, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!