ID: 1133325088_1133325103

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1133325088 1133325103
Species Human (GRCh38) Human (GRCh38)
Location 16:4937260-4937282 16:4937313-4937335
Sequence CCACCGCGCGGGCGGGGCTTGGA GACGCCGCCCACCCCCAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 118} {0: 1, 1: 0, 2: 2, 3: 38, 4: 388}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!