ID: 1133331069_1133331077

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1133331069 1133331077
Species Human (GRCh38) Human (GRCh38)
Location 16:4974429-4974451 16:4974461-4974483
Sequence CCTGGGCTTAAGCGATTCTCCGA CCCAAAGTGCTGGGATTACAGGG
Strand - +
Off-target summary {0: 1, 1: 30, 2: 975, 3: 14717, 4: 106371} {0: 3844, 1: 4167, 2: 2966, 3: 3317, 4: 4349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!