ID: 1133346144_1133346150

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1133346144 1133346150
Species Human (GRCh38) Human (GRCh38)
Location 16:5071870-5071892 16:5071905-5071927
Sequence CCTGCTGGCGCTGTGTCTGCTGC TGCTGGGAGGATGGAAGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 28, 4: 293} {0: 1, 1: 0, 2: 1, 3: 27, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!