ID: 1133394376_1133394380

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1133394376 1133394380
Species Human (GRCh38) Human (GRCh38)
Location 16:5434277-5434299 16:5434325-5434347
Sequence CCAGACACACGCATCAGAGGGAG TTTTTTTTTTTTTTTGAGGCAGG
Strand - +
Off-target summary No data {0: 833, 1: 14576, 2: 18633, 3: 42286, 4: 172953}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!