ID: 1133394376_1133394381

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1133394376 1133394381
Species Human (GRCh38) Human (GRCh38)
Location 16:5434277-5434299 16:5434326-5434348
Sequence CCAGACACACGCATCAGAGGGAG TTTTTTTTTTTTTTGAGGCAGGG
Strand - +
Off-target summary No data {0: 803, 1: 14764, 2: 18397, 3: 39449, 4: 163102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!