ID: 1133496487_1133496496

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1133496487 1133496496
Species Human (GRCh38) Human (GRCh38)
Location 16:6323030-6323052 16:6323080-6323102
Sequence CCAGCTTCCCTCTGCATATAAGG TCGAATGAGTACATGAGCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 196} {0: 1, 1: 0, 2: 1, 3: 4, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!