ID: 1133522590_1133522598

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1133522590 1133522598
Species Human (GRCh38) Human (GRCh38)
Location 16:6573701-6573723 16:6573733-6573755
Sequence CCTCCCGAAAGAGACACTTGGTA CGGGCGCGAAGCCCGGCTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 69} {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!