ID: 1133639357_1133639369

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1133639357 1133639369
Species Human (GRCh38) Human (GRCh38)
Location 16:7701916-7701938 16:7701969-7701991
Sequence CCTGTTGCAGCAAACCAGGGTGC TCTTTCTGTAGGGCAGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103} {0: 1, 1: 0, 2: 2, 3: 34, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!