ID: 1133682061_1133682065

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1133682061 1133682065
Species Human (GRCh38) Human (GRCh38)
Location 16:8129048-8129070 16:8129075-8129097
Sequence CCAAGACACAGGCTCAGGAGATC CAACATGTGCCCAAGGTGGTTGG
Strand - +
Off-target summary No data {0: 55, 1: 404, 2: 690, 3: 673, 4: 554}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!