ID: 1133690808_1133690820

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133690808 1133690820
Species Human (GRCh38) Human (GRCh38)
Location 16:8213234-8213256 16:8213280-8213302
Sequence CCTATAAAACCCCTGAGAGCCGG CCCAGCATTTTGGAAGGCTGAGG
Strand - +
Off-target summary No data {0: 214, 1: 7814, 2: 105433, 3: 233781, 4: 346197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!