ID: 1133872934_1133872943

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1133872934 1133872943
Species Human (GRCh38) Human (GRCh38)
Location 16:9706415-9706437 16:9706465-9706487
Sequence CCAGCATTCCTTCCTGATAAGAG GGTTTACAGAGGCTGCACATAGG
Strand - +
Off-target summary {0: 24, 1: 53, 2: 69, 3: 63, 4: 325} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!