ID: 1133974611_1133974624

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1133974611 1133974624
Species Human (GRCh38) Human (GRCh38)
Location 16:10591708-10591730 16:10591754-10591776
Sequence CCAGACTCCCCTAACCAGAGAGA GCTCAGAGCTGAAAAAATACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!