ID: 1134037151_1134037161

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1134037151 1134037161
Species Human (GRCh38) Human (GRCh38)
Location 16:11039901-11039923 16:11039940-11039962
Sequence CCACAGGGCCACGCAGTTGTAGG GAGCCTGAGCCCTGGGTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99} {0: 1, 1: 0, 2: 8, 3: 46, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!