ID: 1134057799_1134057809

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1134057799 1134057809
Species Human (GRCh38) Human (GRCh38)
Location 16:11181287-11181309 16:11181314-11181336
Sequence CCTGGCATCCAGAGGAAGAGCCA TGTGGGAAGGCCCACAGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 33, 4: 225} {0: 1, 1: 0, 2: 1, 3: 27, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!