ID: 1134057801_1134057813

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1134057801 1134057813
Species Human (GRCh38) Human (GRCh38)
Location 16:11181295-11181317 16:11181335-11181357
Sequence CCAGAGGAAGAGCCAGGAGTGTG GGCTGTGGCTTCTGACACTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 401} {0: 1, 1: 0, 2: 2, 3: 20, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!