ID: 1134075346_1134075355

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1134075346 1134075355
Species Human (GRCh38) Human (GRCh38)
Location 16:11287087-11287109 16:11287136-11287158
Sequence CCTCAGATTGCTTTAGTTTTTCC GTCTCCCTTTAGGCTCCTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 360} {0: 1, 1: 0, 2: 1, 3: 41, 4: 279}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!