ID: 1134225289_1134225297 |
View in Genome Browser |
Spacer: 20 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1134225289 | 1134225297 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 16:12385394-12385416 | 16:12385437-12385459 |
| Sequence | CCTCAAAGAGTTGGAATTTTTTT | ATTGTGTCCCGCAGGGCTCTAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 13, 3: 85, 4: 782} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||