ID: 1134247657_1134247659

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1134247657 1134247659
Species Human (GRCh38) Human (GRCh38)
Location 16:12552004-12552026 16:12552020-12552042
Sequence CCTGTCTCTAAAAAACGTGGCAA GTGGCAAGTCCAGGCTCAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 22, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!