ID: 1134301502_1134301508

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1134301502 1134301508
Species Human (GRCh38) Human (GRCh38)
Location 16:12995620-12995642 16:12995638-12995660
Sequence CCTTCCACCTTCCCACTGTTAAG TTAAGGTCCCTAAGCCTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 229} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!