ID: 1134401104_1134401108

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1134401104 1134401108
Species Human (GRCh38) Human (GRCh38)
Location 16:13910506-13910528 16:13910537-13910559
Sequence CCTAAAAACACCATCTGGGCTTG TGCCTGTGATCCCAGCACTTTGG
Strand - +
Off-target summary No data {0: 1055, 1: 93536, 2: 232660, 3: 241982, 4: 218767}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!