ID: 1134401104_1134401111

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1134401104 1134401111
Species Human (GRCh38) Human (GRCh38)
Location 16:13910506-13910528 16:13910541-13910563
Sequence CCTAAAAACACCATCTGGGCTTG TGTGATCCCAGCACTTTGGGAGG
Strand - +
Off-target summary No data {0: 3016, 1: 296324, 2: 266060, 3: 153853, 4: 140975}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!