ID: 1134401104_1134401113

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1134401104 1134401113
Species Human (GRCh38) Human (GRCh38)
Location 16:13910506-13910528 16:13910547-13910569
Sequence CCTAAAAACACCATCTGGGCTTG CCCAGCACTTTGGGAGGCTGAGG
Strand - +
Off-target summary No data {0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!