ID: 1134407164_1134407172

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1134407164 1134407172
Species Human (GRCh38) Human (GRCh38)
Location 16:13970585-13970607 16:13970630-13970652
Sequence CCTGCAATCACTGTGCTGTCCCA TGCCACACAGCCACTGCTGGGGG
Strand - +
Off-target summary No data {0: 3, 1: 5, 2: 16, 3: 72, 4: 345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!