ID: 1134463386_1134463387

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1134463386 1134463387
Species Human (GRCh38) Human (GRCh38)
Location 16:14449747-14449769 16:14449778-14449800
Sequence CCATTCATAATGCAAAATAAAAC AATATCACTTCTCACCCACTAGG
Strand - +
Off-target summary No data {0: 1, 1: 3, 2: 68, 3: 327, 4: 1043}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!