ID: 1134548351_1134548365

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1134548351 1134548365
Species Human (GRCh38) Human (GRCh38)
Location 16:15127342-15127364 16:15127388-15127410
Sequence CCCTTCCCGAGCAGCCTTTGGTG CACTGGAAAGTGGCGGCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 0, 3: 13, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!