ID: 1134548351_1134548366

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1134548351 1134548366
Species Human (GRCh38) Human (GRCh38)
Location 16:15127342-15127364 16:15127393-15127415
Sequence CCCTTCCCGAGCAGCCTTTGGTG GAAAGTGGCGGCTCTGGGCATGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 4, 3: 24, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!