ID: 1134618256_1134618262

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134618256 1134618262
Species Human (GRCh38) Human (GRCh38)
Location 16:15668506-15668528 16:15668521-15668543
Sequence CCTCCTGCCTTGGCCTCCCAAAT TCCCAAATTGCTGGGATTATAGG
Strand - +
Off-target summary {0: 437, 1: 28558, 2: 79961, 3: 162520, 4: 174890} {0: 385, 1: 33600, 2: 344762, 3: 319397, 4: 289577}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!