ID: 1134618259_1134618265

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1134618259 1134618265
Species Human (GRCh38) Human (GRCh38)
Location 16:15668513-15668535 16:15668538-15668560
Sequence CCTTGGCCTCCCAAATTGCTGGG TATAGGCATGAGCCACCACCTGG
Strand - +
Off-target summary {0: 1101, 1: 87148, 2: 211799, 3: 247948, 4: 265763} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!