ID: 1134618264_1134618265

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134618264 1134618265
Species Human (GRCh38) Human (GRCh38)
Location 16:15668523-15668545 16:15668538-15668560
Sequence CCAAATTGCTGGGATTATAGGCA TATAGGCATGAGCCACCACCTGG
Strand - +
Off-target summary {0: 168, 1: 13394, 2: 130816, 3: 321012, 4: 348266} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!