ID: 1134710151_1134710156

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1134710151 1134710156
Species Human (GRCh38) Human (GRCh38)
Location 16:16323643-16323665 16:16323658-16323680
Sequence CCGCAGGTGCAGCCGTTCACCCC TTCACCCCGGGCTCCTCAGGCGG
Strand - +
Off-target summary No data {0: 6, 1: 0, 2: 2, 3: 11, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!