ID: 1134759144_1134759158

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1134759144 1134759158
Species Human (GRCh38) Human (GRCh38)
Location 16:16698217-16698239 16:16698246-16698268
Sequence CCTGGGCTCCTCCCTGCCCCCTC GCCCCTGGGTTGGAAGATGAAGG
Strand - +
Off-target summary {0: 2, 1: 3, 2: 14, 3: 212, 4: 1435} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!