ID: 1134813213_1134813218

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1134813213 1134813218
Species Human (GRCh38) Human (GRCh38)
Location 16:17184986-17185008 16:17185007-17185029
Sequence CCACATCCTTCCCAGAAGGTCCT CTAAGCCCATAGACCACTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!