ID: 1134986909_1134986917

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1134986909 1134986917
Species Human (GRCh38) Human (GRCh38)
Location 16:18660897-18660919 16:18660944-18660966
Sequence CCCATAACCTCACTCATAAGCAT TCTTCCAACCCAGGGGCACAGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 40, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!