ID: 1135158174_1135158180

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1135158174 1135158180
Species Human (GRCh38) Human (GRCh38)
Location 16:20072131-20072153 16:20072152-20072174
Sequence CCACCCCGGCAGGGCAAGTCAGA GAGGCTGAGCTGCTCTCCTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 108} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!