ID: 1135167963_1135167968

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1135167963 1135167968
Species Human (GRCh38) Human (GRCh38)
Location 16:20157143-20157165 16:20157181-20157203
Sequence CCCTTTAAATGCATTGCTGCATC CCATTCCAATGTAAGATCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 423} {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!