ID: 1135245713_1135245718

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1135245713 1135245718
Species Human (GRCh38) Human (GRCh38)
Location 16:20855271-20855293 16:20855314-20855336
Sequence CCTTTAAAACCTAGTCATATTCA AATTAAGCACAGACGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 238} {0: 1, 1: 0, 2: 0, 3: 6, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!