ID: 1135409887_1135409897

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1135409887 1135409897
Species Human (GRCh38) Human (GRCh38)
Location 16:22225646-22225668 16:22225695-22225717
Sequence CCTTGTAGGACCTTCGCCTCTGC GGATACTGCTTGGGTAAAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 84} {0: 1, 1: 0, 2: 1, 3: 2, 4: 99}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
26 16:22225646-22225668 CCTTGTAGGACCTTCGCCTCTGC - 16:22225695-22225717 GGATACTGCTTGGGTAAAACGGG +