ID: 1135422081_1135422082 |
View in Genome Browser |
Spacer: -6 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1135422081 | 1135422082 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 16:22312124-22312146 | 16:22312141-22312163 |
Sequence | CCTGGTTCTTTTTGTGGTGATGA | TGATGAGAATGTTCTAAAATTGG |
Strand | - | + |
Off-target summary | No data | {0: 2, 1: 33, 2: 130, 3: 251, 4: 777} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |