ID: 1135422081_1135422082

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1135422081 1135422082
Species Human (GRCh38) Human (GRCh38)
Location 16:22312124-22312146 16:22312141-22312163
Sequence CCTGGTTCTTTTTGTGGTGATGA TGATGAGAATGTTCTAAAATTGG
Strand - +
Off-target summary No data {0: 2, 1: 33, 2: 130, 3: 251, 4: 777}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!